Informations

L'euchromatine peut-elle se transformer en hétérochromatine ?

L'euchromatine peut-elle se transformer en hétérochromatine ?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

je sais que L'hétérochromatine peut se transformer en euchromatine mais l'inverse est-il possible? Si oui, alors comment ?


Je suggérerais à l'avenir de faire une petite recherche avant de demander. Par exemple, la page wikipedia pour l'euchromatine dit ceci :

L'euchromatine participe à la transcription active de l'ADN en produits d'ARNm. La structure dépliée permet aux protéines régulatrices des gènes et aux complexes d'ARN polymérase de se lier à la séquence d'ADN, ce qui peut alors initier le processus de transcription. Toute l'euchromatine n'est pas nécessairement transcrite, mais en général celle qui ne l'est pas est transformée en hétérochromatine pour protéger les gènes lorsqu'ils ne sont pas utilisés. Il existe donc un lien direct entre la productivité active d'une cellule et la quantité d'euchromatine présente dans son noyau. On pense que la cellule utilise la transformation de l'euchromatine en hétérochromatine comme méthode de contrôle de l'expression et de la réplication des gènes, car de tels processus se comportent différemment sur la chromatine densément compactée, connue sous le nom d'« hypothèse d'accessibilité ». Un exemple d'euchromatine constitutive qui est «toujours activée» est celui des gènes domestiques, qui codent pour les protéines nécessaires aux fonctions de base de la survie cellulaire.

L'hétérochromatine facultative est la chromatine qui se convertit en fonction des circonstances. Cela se produit par (dé)"condensation" ou (dé)"compactage" de la chromatine :

Parmi les composants moléculaires qui semblent réguler la propagation de l'hétérochromatine figurent les protéines du groupe Polycomb et les gènes non codants tels que Xist. Le mécanisme d'une telle propagation est encore un sujet de controverse.[19] Les complexes répressifs polycomb PRC1 et PRC2 régulent la compaction de la chromatine et l'expression des gènes et ont un rôle fondamental dans les processus de développement.

Je suggérerais de lire ces pages un peu et de poser une question plus précise s'ils n'y répondent pas.


Différence entre l'euchromatine et l'hétérochromatine

Notre corps est composé de milliards de cellules. Une cellule typique contient un noyau et le noyau contient de la chromatine. Selon les biochimistes, la définition opérationnelle de la chromatine est le complexe ADN, protéine, ARN extrait de noyaux d'interphase lysés eucaryotes. Selon eux, la chromatine est le produit formé à partir des protéines spéciales conditionnées communément appelées histones. Pour le dire simplement, la chromatine est principalement la combinaison d'acide désoxyribonucléique ou simplement d'ADN et d'autres types de protéines. La chromatine est responsable de l'emballage de l'ADN dans des volumes plus petits afin qu'ils puissent s'adapter à l'intérieur de la cellule. Il est également responsable du renforcement de l'ADN pour la mitose et la méiose. La chromatine empêche également d'endommager l'ADN et contrôle l'expression des gènes et la réplication de l'ADN.

Il existe deux variétés de chromatine. Ce sont l'euchromatine et l'hétérochromatine. Ces deux formes se distinguent d'une manière cytologique en fonction de l'intensité de la coloration de chaque forme. L'euchromatine est moins intense que l'hétérochromatine. Cela indique seulement que l'hétérochromatine a un emballage d'ADN plus serré. Pour en savoir plus sur la différence entre l'euchromatine et l'hétérochromatine, cet article vous donnera un aperçu rapide de ces deux formes de chromatine.

Le matériau légèrement tassé est appelé euchromatine. Bien qu'il soit légèrement emballé sous forme d'ADN, d'ARN et de protéines, il est certainement riche en concentration de gènes et est généralement en cours de transcription active. Si vous allez examiner des eucaryotes et des procaryotes, vous constaterez la présence d'euchromatine. L'hétérochromatine ne se trouve que chez les eucaryotes. Lorsqu'elle est colorée et observée au microscope optique, l'euchromatine ressemble à des bandes de couleur claire tandis que l'hétérochromatine est de couleur foncée. La structure standard de l'euchromatine est dépliée, allongée et seulement de la taille d'une microfibrille de 10 nanomètres. Cette minuscule chromatine fonctionne dans la transcription de l'ADN en produits d'ARNm. Les protéines régulatrices des gènes, y compris les complexes d'ARN polymérase, sont capables de se lier à la séquence d'ADN en raison de la structure dépliée de l'euchromatine. Lorsque ces substances sont déjà liées, le processus de transcription commence. Les activités de l'euchromatine contribuent à la survie des cellules.

D'autre part, l'hétérochromatine est une forme d'ADN très compacte. On le trouve couramment sur les zones périphériques du noyau. Selon certaines études, il existe probablement deux ou plusieurs états d'hétérochromatine. Les séquences satellites inactives sont les principaux constituants de l'hétérochromatine. L'hétérochromatine est responsable de la régulation des gènes et de la protection de l'intégrité chromosomique. Ces rôles sont rendus possibles en raison de l'emballage dense de l'ADN. Lorsque deux cellules filles sont séparées d'une seule cellule mère, l'hétérochromatine est généralement héritée, ce qui signifie que l'hétérochromatine nouvellement clonée contient les mêmes régions d'ADN, ce qui entraîne un héritage épigénétique. Il peut y avoir l'apparition de refoulement de matériaux transscriptibles en raison des domaines limites. Cet événement peut conduire au développement de différents niveaux d'expression des gènes.

Le résumé suivant vous permet de mieux comprendre les deux formes de chromatine : l'euchromatine et l'hétérochromatine.

La chromatine constitue le noyau. Il est composé d'ADN et de protéines.

La chromatine a deux formes : l'euchromatine et l'hétérochromatine.

Lorsqu'elles sont colorées et observées au microscope optique, les euchromatines sont les bandes de couleur claire tandis que les hétérochromatines sont les bandes de couleur foncée.

Une coloration plus foncée indique un emballage d'ADN plus serré. Les hétérochromatines ont donc un emballage d'ADN plus serré que les euchromatines.

Les hétérochromatines sont des régions enroulées de manière compacte, tandis que les euchromatines sont des régions enroulées de manière lâche.

L'euchromatine contient moins d'ADN tandis que l'hétérochromatine contient plus d'ADN.

L'euchromatine est précocement réplicative tandis que l'hétérochromatine est tardivement réplicative.

L'euchromatine se trouve dans les eucaryotes, les cellules avec noyaux, et les procaryotes, les cellules sans noyaux.

L'hétérochromatine ne se trouve que chez les eucaryotes.

Les fonctions de l'euchromatine et de l'hétérochromatine sont l'expression génique, la répression génique et la transcription de l'ADN.


Structure de l'hétérochromatine : les leçons de la levure bourgeonnante

Le génome eucaryote peut être grossièrement divisé en domaines euchromatine et hétérochromatine qui sont structurellement et fonctionnellement distincts. L'hétérochromatine se caractérise par sa grande compacité et son effet inhibiteur sur les transactions de l'ADN telles que l'expression des gènes. La formation d'hétérochromatine implique des modifications spéciales des histones ainsi que le recrutement et la propagation de complexes de silençage et provoque des changements dans les structures d'ordre primaire et supérieur de la chromatine. Les deux dernières décennies ont vu des progrès spectaculaires dans la dissection des aspects moléculaires de l'hétérochromatine en raison de l'identification du code histone pour l'hétérochromatine ainsi que de ses auteurs et effaceurs (enzymes modifiant les histones) et lecteurs (facteurs de silence reconnaissant les modifications histones). On a commencé à comprendre comment les modifications hétérochromatiques des histones et les facteurs de silençage contribuent aux structures spéciales d'ordre primaire et supérieur de l'hétérochromatine. La levure bourgeonnante Saccharomyces cerevisiae a longtemps été utilisée comme organisme modèle pour les études sur l'hétérochromatine. Les résultats de ces études ont contribué de manière significative à l'élucidation des principes généraux régissant la formation, le maintien et la fonction de l'hétérochromatine. Cette revue se concentre sur les recherches sur les aspects structurels de l'hétérochromatine chez S. cerevisiae. La compréhension actuelle des autres aspects de l'hétérochromatine, y compris la façon dont elle favorise l'extinction des gènes et son héritage épigénétique, est brièvement résumée.

Mots clés: Saccharomyces cerevisiae Sir protéines hétérochromatine d'ordre supérieur structure de la chromatine silence transcriptionnel.


Principales différences entre l'hétérochromatine et l'euchromatine

Voici les points importants à différencier entre l'hétérochromatine et l'euchromatine :

  1. La forme serrée d'ADN dans le chromosome est appelée comme hétérochromatine, tandis que la forme lâche de l'ADN dans le chromosome est appelée euchromatine.
  2. Dans l'hétérochromatine, le densité de l'ADN est haute et sont taché de noir, alors que dans l'euchromatine, la densité de l'ADN est peu et sont légèrementcoloré.
  3. L'hétérochromatine est trouvé à la périphérie du noyau dans les cellules eucaryotes uniquement, et l'euchromatine est situé dans le corps interne du noyau des cellules procaryotes ainsi que dans les cellules eucaryotes.
  4. L'hétérochromatine montre peu ou aucune activité transcriptionnelle aussi bien ils sont génétiquement inactif, d'autre part, l'euchromatine activement participe au processus de transcription et sont génétiquement actif aussi.
  5. L'hétérochromatine est enroulé de manière compacte et est réplicatif tardif, alors que l'euchromatine est lâchement enroulé et réplicatif précoce.
  6. Régions d'hétérochromatine sont collantes, mais les zones d'euchromatine ne sont pas collantes.
  7. Dans la partie hétérochromatine, le phénotype reste inchangé d'un organisme, bien que des variations puissent être observées, en raison de l'effet sur l'ADN au cours du processus génétique dans l'euchromatine.
  8. L'hétérochromatine permet la régulation de l'expression des gènes et maintient également l'intégrité structurelle de la cellule bien que l'euchromatine entraîne variations génétiques, et permet la transcription génétique.

Conclusion

D'après les informations ci-dessus concernant la chromatine, leur structure et leurs types. Nous pouvons dire que seule l'euchromatine est activement impliquée dans le processus de transcription bien que l'hétérochromatine et ses types ne jouent pas un rôle aussi important.

L'hétérochromatine constitutive contient l'ADN satellite et entoure le centromère, et l'hétérochromatine facultative est dissoute. On peut donc apparemment dire que les cellules eucaryotes et leur structure interne sont relativement complexes.


Citation: Hughes SE, Hawley RS (2009) Hétérochromatine : une barrière d'espèces en évolution rapide. PLoS Biol 7(10) : e1000233. https://doi.org/10.1371/journal.pbio.1000233

Publié : 27 octobre 2009

Droits d'auteur: © 2009 Hughes, Hawley. Il s'agit d'un article en libre accès distribué selon les termes de la licence d'attribution Creative Commons, qui permet une utilisation, une distribution et une reproduction sans restriction sur n'importe quel support, à condition que l'auteur et la source d'origine soient crédités.

Intérêts concurrents : Les auteurs ont déclaré qu'ils n'existaient pas de conflit d'intérêts.

Il y a près de 100 ans, les biologistes ont divisé les régions des chromosomes en deux types, l'euchromatine et l'hétérochromatine, sur la base de leur apparence (revue dans [1]). La classification initiale de l'ADN était basée sur l'observation que les régions euchromatiques modifiaient leur degré de condensation au cours du cycle de division cellulaire, tandis que les régions hétérochromatiques restaient fortement condensées pendant la majeure partie du cycle cellulaire. Bien que la signification biologique de l'hétérochromatine soit restée obscure pendant de nombreuses années, il est maintenant évident que l'hétérochromatine joue un certain nombre de rôles biologiques, y compris un rôle récemment identifié dans la spéciation. En plus des différences dans le calendrier de condensation des chromosomes, de nombreuses autres différences ont été identifiées entre l'euchromatine et l'hétérochromatine. L'euchromatine est enrichie de séquences codantes uniques et les gènes de l'euchromatine sont généralement activement transcrits. L'hétérochromatine, d'autre part, est considérée comme pauvre en gènes, étant principalement composée de réseaux de séquences simples hautement répétitives, telles que des séquences satellites et/ou des éléments transposables. L'hétérochromatine est enrichie au niveau des centromères (voir Figure 1) et des télomères des chromosomes.

L'illustration montre un chromosome acrocentrique représentatif contenant à la fois des régions hétérochromatiques condensées (gris foncé) et des régions euchromatiques moins condensées (gris clair). A côté de chaque région se trouvent des caractéristiques typiques de chaque type de chromatine.

Un certain nombre de modifications de la chromatine sont spécifiquement associées à l'hétérochromatine ou à l'euchromatine, telles que des modèles de méthylation spécifiques sur les histones. Les protéines impliquées dans la création des modèles de méthylation des histones associés à l'hétérochromatine, ainsi que des protéines, telles que la protéine d'hétérochromatine 1 (HP1) qui sont impliquées dans la formation de l'hétérochromatine et le silençage génique, se trouvent préférentiellement localisées dans l'ADN hétérochromatique. Enfin, l'hétérochromatine semble évoluer rapidement, de sorte que la composition des séquences des régions hétérochromatiques d'espèces même étroitement apparentées est souvent distincte. La rareté des gènes dans l'hétérochromatine, ainsi que son évolution rapide, ont conduit de nombreux scientifiques du 20e siècle à considérer l'hétérochromatine comme rien de plus qu'un ADN « poubelle » avec peu d'importance biologique, autre que de comprendre, et peut-être de protéger, les centromères et les télomères.

La mouche des fruits Drosophila melanogaster et ses proches parents ont été des modèles populaires pour étudier la nature et la formation de l'hétérochromatine (examiné dans [1]). Chez ces espèces, l'euchromatine se distingue facilement de l'hétérochromatine péricentrique, qui entoure les centromères des chromosomes mitotiques, par cytologie en raison des différences de condensation des deux types d'ADN. De plus, les régions hétérochromatiques ne parviennent pas à se répliquer dans les chromosomes polytènes, qui sont des chromosomes hautement répliqués qui restent étroitement associés dans les glandes salivaires larvaires. Cela permet une démarcation raisonnablement précise de la jonction entre l'euchromatine et l'hétérochromatine. En outre, D. melanogaster est un système hautement maniable pour effectuer des criblages génétiques et pour effectuer des manipulations génétiques avancées. Parce que l'hétérochromatine et l'euchromatine sont facilement disséquées génétiquement dans D. melanogaster, la biologie de l'hétérochromatine a été intensément étudiée en utilisant cet organisme.

En effet, travailler dans D. melanogaster a commencé à remettre en question le point de vue de l'hétérochromatine en tant qu'ADN « poubelle » et a démontré que l'hétérochromatine joue un certain nombre de fonctions cellulaires importantes. Les premières indications d'une « fonction » pour l'hétérochromatine sont venues d'études sur les multiples rôles de l'hétérochromatine dans la médiation de la recombinaison au cours de la méiose [2],[3]. Peut-être plus important encore, le fait de placer des gènes normalement euchromatiques près de l'hétérochromatine provoque le silence variable de ces gènes, un effet connu sous le nom de panachure à effet de position, ou PEV (examiné dans [1]). Cet effet de silençage et le fait que certains gènes doivent être dans l'hétérochromatine pour être correctement transcrits suggèrent que l'hétérochromatine peut jouer un rôle essentiel dans le contrôle global de la régulation génique [4]–[6].

De plus, les expériences de Karpen, Dernburg, Hawley et de leurs collaborateurs ont démontré que l'appariement des régions hétérochromatiques est nécessaire pour la ségrégation appropriée des chromosomes qui ne subissent pas de recombinaison pendant la méiose féminine [7]–[9]. Des travaux ultérieurs ont démontré que les chromosomes qui ne subissent pas de recombinaison (le X et 4 ème ) sont reliés par des fils hétérochromatiques au cours de la prométaphase I dans les ovocytes et que ces fils font probablement partie du mécanisme par lequel l'hétérochromatine facilite la ségrégation des chromosomes non recombinants [10].

Preuve de fils reliant les chromosomes pendant la méiose dans le sperme des deux D. melanogaster et les grues suggèrent une fonction conservée pour les structures filiformes dans la ségrégation des chromosomes pendant la méiose [11], [12]. Bien qu'il n'ait pas encore été déterminé si ces fils sont composés d'hétérochromatine, la région d'espacement intergénique répétitive de l'ADNr, qui réside dans l'hétérochromatine, est nécessaire pour l'appariement correct du Oui chromosome avec le X chromosome pendant la méiose masculine dans D. melanogaster [13]. Enfin, des types de fils similaires ont été observés émanant des régions centromériques hétérochromatiques des chromosomes pendant la mitose dans les cellules de mammifères, suggérant que les fils hétérochromatiques jouent également un rôle important dans la ségrégation des chromosomes pendant la mitose [14], [15].

Compte tenu des fonctions critiques des séquences hétérochromatiques dans la méiose et la mitose et de son changement rapide de séquence tout au long de l'évolution, il n'est peut-être pas surprenant que des différences dans les séquences hétérochromatiques ou les protéines qui les maintiennent puissent effectivement jouer un rôle dans l'isolement des espèces [16]. L'accouplement d'espèces apparentées conduit parfois à la mort ou à la stérilité de l'un ou des deux sexes de la progéniture, ce qui est connu sous le nom d'incompatibilité hybride. Bien que l'incompatibilité hybride ait été étudiée pendant des décennies, il n'y a eu que peu d'informations sur les mécanismes moléculaires qui la sous-tendent, et dans ces cas connus pour le Drosophile espèces, l'incompatibilité hybride a impliqué des gènes codant pour des protéines [17],[18]. Cependant, dans ce numéro de Biologie PLoS Ferree et Barbash démontrent que la divergence rapide de l'hétérochromatine joue également un rôle important dans le maintien de l'isolement reproductif de D. melanogaster de l'espèce sœur Drosophila simulans [16]. Le croisement entre D. simulans les femmes et D. melanogaster les mâles sont inhabituels en ce que la progéniture mâle est viable mais les femelles meurent au cours du développement embryonnaire [19]. (Généralement en cas d'incompatibilité hybride, les mâles hétérogamétiques sont le sexe affecté si un seul sexe est stérile ou mortel.)

Ferree et Barbash ont découvert que la létalité des embryons femelles hybrides résultait d'échecs au cours des divisions mitotiques 10-13 [16]. Chez ces femelles, les régions chromosomiques apparaissaient fréquemment très étirées et en retard par rapport aux autres chromosomes lors de l'anaphase de ces divisions mitotiques [16]. L'ADN en retard n'a pas réussi à se séparer correctement de sa sœur pendant la mitose, ce qui a entraîné une ségrégation chromosomique inappropriée, des divisions mitotiques aberrantes et, finalement, la mort des embryons femelles.

En utilisant l'hybridation fluorescente in situ, les auteurs ont déterminé que la chromatine retardée était principalement composée de la répétition hétérochromatique et hautement répétitive de 359 pb sur le X chromosome de la D. melanogaster père [16]. Ce type de répétition hétérochromatique particulier a une composition de séquence différente et est beaucoup moins abondant dans D. simulans. La région contenant une répétition de 359 pb sur le D. melanogaster X chromosome chevauche également le Zhr locus, une région génétique qui a été identifiée parce que sa suppression du D. melanogaster X chromosome autorisé D. melanogaster mâles pour produire des filles hybrides viables lorsqu'ils sont croisés avec D. simulans femmes [19].

La découverte que la létalité chez les femelles hybrides résulte d'un échec à maintenir l'intégrité d'une région hétérochromatique de la D. melanogaster X chromosome contenant la séquence répétée de 359 pb suggère une possibilité intrigante, à savoir que le retard chromosomique et la létalité du D. melanogaster X l'hétérochromatine chromosomique chez les hybrides femelles se produit parce que le D. simulans la mère ne parvient pas à fournir une protéine ou une molécule d'ARN nécessaire au bon maintien et/ou à la séparation pendant la mitose de la région répétée de 359 pb fournie par le D. melanogaster père (voir la figure 2). On pourrait même imaginer que l'échec de la ségrégation mitotique observé ici reflète un échec à résoudre correctement les fils hétérochromatiques observés pour connecter l'hétérochromatine péricentromérique dans les cellules mitotiques et méiotiques (voir ci-dessus).

Ce modèle est basé sur les résultats de l'article publié par Ferree et Barbash dans ce numéro de Biologie PLoS [16]. Un croisement entre D. melanogaster les mâles et D. simulans les femelles, ce qui donne des femelles hybrides qui meurent au début de l'embryogenèse, est illustré à droite. Le dessin de gauche représente un croisement entre D. melanogaster mâles à D. melanogaster femelles pour comparaison. Pour simplifier, seuls les X les chromosomes sont affichés et la région hétérochromatique est spécifiée avec une couleur plus foncée. Dans les deux croisements, la fusion du sperme et de l'ovule donne des zygotes portant une paire de X chromosomiques. La croix avec le D. melanogaster femelles conduit à une ségrégation chromosomique normale pendant l'anaphase des divisions mitotiques 10 à 13 chez les embryons femelles. Dans la croix avec D. simulans la mitose des femelles ne se termine pas normalement dans les embryons femelles hybrides. Alors que la mère X les chromosomes se séparent normalement vers les pôles opposés du fuseau, les centromères de ségrégation des dérivés paternels X les chromosomes sont reliés par un pont de chromatine. Ce pont, hétérochromatique et composé d'une région riche en répétition de 359 pb, provoque une mauvaise ségrégation des chromatides sœurs de la X chromosome, un événement qui conduit finalement à des divisions mitotiques aberrantes et finalement à la mort des embryons hybrides femelles. Le retard ou le pontage de la région des 359 pb est probablement dû à l'absence d'un facteur de charge maternelle dans le D. simulans œuf (indiqué sous forme de losanges jaunes dans le D. melanogaster Oeuf). Nous imaginons que ce facteur pourrait être impliqué dans la résolution des fils hétérochromatiques qui se sont avérés connecter les régions péricentromériques des chromosomes mitotiques et méiotiques dans les cellules normales (voir le texte pour une description). L'absence de ce facteur empêche la formation ou le maintien correct de la structure de la chromatine dans la région de répétition de 359 pb dans les embryons hybrides femelles.

Les auteurs soupçonnaient que D. simulans manque d'un facteur requis pour maintenir la stabilité hétérochromatique ou pour résoudre les liaisons hétérochromatiques dans D. melanogaster X hétérochromatine chromosomique au cours des divisions mitotiques embryonnaires. En effet, ils ont découvert que la topoisomérase II, une enzyme requise pour une mitose correcte, présentait une localisation aberrante de l'ADN en retard dans les embryons hybrides. Des travaux supplémentaires seront nécessaires pour déterminer si d'autres protéines ou molécules d'ARN sont absentes ou localisées de manière aberrante à partir du D. simulans cytoplasme maternel, et si leur absence est suffisante pour provoquer les défauts de la région de répétition de 359 pb dans les embryons femelles hybrides.

Bien qu'il s'agisse du premier exemple d'une séquence hétérochromatique provoquant une incompatibilité hybride, d'autres exemples seront probablement trouvés dans la nature. En effet, on ne peut s'empêcher de noter un parallèle entre cet exemple d'inviabilité hybride et un phénomène génétique connu sous le nom de distorsion de ségrégation, qui a également été bien étudié en D. melanogaster [20]. Dans ce système, un nouveau mutant connu sous le nom de Dakota du Sud, qui est situé dans l'euchromatine du chromosome 2, empêche la transmission méiotique des homologues 2 ème chromosomes portant un nombre élevé de copies d'un élément hétérochromatique connu sous le nom Répondeur (Rsp) [21]. La base génétique de ce phénomène, qui provoque une condensation et une fonction inappropriées de Rsp- portant des spermatides, est bien comprise, et une compréhension moléculaire complète de ce processus est à portée de main. Bien que la distorsion de ségrégation soit en effet un exemple de « pulsion méiotique » et non un mécanisme d'isolement d'espèce, elle mérite d'être mentionnée ici car elle illustre un deuxième cas dans lequel un mutant dans une souche altère la fonction d'un élément hétérochromatique dans une autre, illustrant ainsi les mécanismes d'« incompatibilité hétérochromatique » peut être plus fréquente qu'on aurait pu s'y attendre.

Comme l'hétérochromatine change rapidement, les mécanismes qui la maintiennent peuvent bien diverger à mesure que les populations sont isolées par divers mécanismes. Si ces mécanismes changent de telle manière que l'hétérochromatine de la population A ne peut plus être maintenue par les protéines de maintien de la population B, alors l'hétérochromatine elle-même devient une barrière entre ces populations au fur et à mesure que la spéciation se poursuit. De nombreuses autres questions attendent d'être étudiées, à la fois en termes de système d'inviabilité hybride décrit ci-dessus et en termes d'évaluation du degré auquel la sauvegarde de l'intégrité hétérochromatique sous-tend d'autres exemples de spéciation. Mais une chose est claire : si une partie de l'hétérochromatine est en effet « indésirable », alors c'est à la fois « indésirable » dont il faut bien prendre soin et « indésirable » qui distingue une espèce de ses voisines.


La transcription organise l'euchromatine semblable à une microémulsion active

La chromatine est organisée en hétérochromatine, qui est transcriptionnellement inactive, et en euchromatine, qui peut basculer entre les états transcriptionnellement actif et inactif. Ce changement d'activité de l'euchromatine s'accompagne de changements dans sa distribution spatiale. La façon dont les réarrangements de l'euchromatine sont établis est inconnue. Ici, nous utilisons la microscopie à super-résolution et à cellules vivantes pour montrer que l'euchromatine transcriptionnellement inactive s'éloigne de l'euchromatine transcriptionnellement active. Ce mouvement est entraîné par la formation de microenvironnements enrichis en ARN qui excluent l'euchromatine inactive. En utilisant la théorie, nous montrons que la ségrégation dans les microenvironnements enrichis en ARN et les domaines d'euchromatine peut être considérée comme une microémulsion active. L'attachement des transcrits à la chromatine via l'ARN polymérase II forme des amphiphiles efficaces qui intercalent les deux phases séparées. Conjuguées aux expériences précédentes, nos données suggèrent que la chromatine est organisée de la manière suivante : l'hétérochromatine se sépare de l'euchromatine par séparation de phases, tandis que la transcription organise l'euchromatine de la même manière qu'une microémulsion active.


Résumé

L'hétérochromatine est une caractéristique architecturale clé des chromosomes eucaryotes, qui confère à des domaines génomiques particuliers des propriétés fonctionnelles spécifiques. La capacité de l'hétérochromatine à restreindre l'activité des éléments mobiles, à isoler la réparation de l'ADN dans les régions répétitives et à assurer une ségrégation précise des chromosomes est cruciale pour maintenir la stabilité génomique. Les nucléosomes des régions d'hétérochromatine présentent des modifications post-traductionnelles des histones qui contribuent à la régulation du développement en restreignant l'expression des gènes spécifiques à la lignée. Les mécanismes de l'établissement de l'hétérochromatine et du maintien de l'hétérochromatine sont séparables et impliquent la capacité de facteurs spécifiques de séquence liés aux transcrits naissants à recruter des enzymes modifiant la chromatine. L'hétérochromatine peut se propager le long de la chromatine à partir des sites de nucléation. La propension de l'hétérochromatine à favoriser sa propre propagation et sa propre transmission est contrecarrée par des facteurs inhibiteurs. En raison de son importance pour la fonction chromosomique, l'hétérochromatine joue un rôle clé dans la pathogenèse de diverses maladies humaines. Dans cette revue, nous discutons des principes conservés de la formation et de la fonction de l'hétérochromatine à l'aide d'exemples sélectionnés d'études sur une gamme d'eucaryotes, de la levure à l'homme, en mettant l'accent sur les informations obtenues à partir d'organismes modèles unicellulaires.


Organisation des chromosomes

Natella I. Enukashvily , Nikita V. Ponomartsev , dans Advances in Protein Chemistry and Structural Biology , 2013

1. Introduction

En 1928, Heitz a suggéré les termes euchromatine et hétérochromatine (HC) pour les différences détectables par des colorations chromosomiques appropriées ( Heitz, 1928). Il a coloré les cellules de plusieurs espèces de mousse avec de l'acide acétique carmin et a observé un type de chromatine dans le noyau qui restait condensé tout au long du cycle cellulaire. Heitz a décrit cette partie de la chromatine nucléaire comme de l'hétérochromatine, qui maintenait un état condensé (c'est-à-dire apparaissait sombre) tout au long de l'interphase cellulaire, tandis que le reste de la chromatine nucléaire s'étendait jusqu'à ce qu'il appelait l'état euchromatine. Cooper (1959) a pu résumer les données de la drosophile et a suggéré que l'hétérochromatine et l'euchromatine différaient dans leurs conformations biophysiques et dans l'expression métabolique de leurs gènes, mais pas dans leur structure de base de l'ADN disposé dans les chromosomes. Aujourd'hui, le concept d'un génome eucaryote composé de deux types de chromatine emballées différemment est largement accepté et il est inclus dans les manuels scolaires de biologie. Bien que le terme hétérochromatine ait été défini à l'origine cytologiquement comme des régions de chromosomes mitotiques qui restent condensés dans l'interphase, il est maintenant appliqué de manière plus lâche pour inclure des régions de chromosomes qui présentent des propriétés caractéristiques telles que, par exemple, la répression génique et le silence (examiné par Craig, 2005 Lohe & Hilliker, 1995).

Il est communément admis qu'il existe deux types d'hétérochromatine : constitutive et facultative. On pense que l'HC constitutive est condensée tout au long du cycle cellulaire, contrairement à l'HC facultative qui est régulée par le développement. Dans les chromosomes mitotiques, les régions hétérochromatiques constitutives sont positionnées le plus souvent dans les régions centromériques et péricentromériques ainsi qu'à proximité des télomères. Les chromosomes 1, 9, 16 et Y contiennent de gros blocs d'hétérochromatine. L'HC facultative peut être formée sur différentes régions chromosomiques. Chez les mammifères femelles, un chromosome X (d'origine maternelle ou paternelle) est inactivé au hasard dans les cellules embryonnaires précoces, avec une inactivation fixe dans toutes les cellules descendantes (Lyon, 1961). Des HC facultatives peuvent être formées dans les régions promotrices de gènes non transcrits (Rand & Cedar, 2003). Certains des néocentromères (régions de l'ADN euchromatique qui ont acquis les propriétés des centromères) connus à ce jour peuvent subir une hétérochromatinisation bien qu'ils soient formés dans des régions euchromatiques ( Amor & Choo, 2002 Saffery et al., 2003 ).


Fonction euchromatine

Malgré des recherches actives, la structure de la chromatine est encore mal comprise bien qu'il semble que le cycle dans lequel se trouve la cellule à un certain moment détermine la structure de la chromatine. Sans surprise, la structure de l'euchromatine fournit des indications concernant sa fonction et pourquoi elle est présente dans les cellules transcriptionnellement actives. Comme mentionné ci-dessus, l'euchromatine est également appelée perles sur une chaîne en raison de la ressemblance entre un collier de perles connecté via une chaîne et les nucléosomes connectés via l'ADN de liaison. Dans cette conformation, l'euchromatine est lâche et laisse par conséquent l'ADN de liaison exposé afin qu'il puisse être transcrit de cette manière, les ARN et ADN polymérases ainsi que d'autres protéines peuvent accéder à l'ADN. En raison de sa structure lâche, l'euchromatine est difficile à voir au microscope et apparaît faiblement lorsqu'elle est colorée, contrairement à l'hétérochromatine facilement visible, qui est densément emballée.


MATÉRIAUX ET MÉTHODES

Système d'imagerie OI-DIC pour échantillons biologiques

Le schéma principal du système de microscopie OI-DIC est illustré à la figure 1A. Le microscope comprend une source lumineuse avec un filtre passe-bande, un polariseur et analyseur linéaire croisé, un déphaseur, un condenseur et des lentilles d'objectif, une lentille tubulaire et une caméra numérique à dispositif à couplage de charge (CCD). Pour surmonter les limites de l'imagerie DIC conventionnelle, le microscope contient deux ensembles de cisaillement du faisceau (Shribak, 2014). Chaque ensemble se compose de deux prismes DIC identiques et d'un rotateur de polarisation à 90°. La polarisation de la lumière en rotation par les rotateurs permet aux directions de cisaillement d'être rapidement commutées de 90 ° sans faire tourner mécaniquement les échantillons (par exemple, les cellules vivantes) ou les prismes. Nous avons capturé six images brutes en utilisant la microscopie OI-DIC, avec deux directions de cisaillement perpendiculaires et trois biais ± 0,15λ et 0, où est la longueur d'onde. Les images OI-DIC capturées ont été traitées en images OPD (cartes) dont l'intensité correspondait linéairement à la valeur OPD. Le traitement des images a été effectué à l'aide d'un logiciel maison (OIDIC.exe). Cet algorithme de traitement et d'autres ont été décrits précédemment (Shribak et Inoue, 2006 Shribak, 2013 Shribak et al., 2017).

Pour comparer OI-DIC avec le microscope à cartographie de phase CellVista SLIM Pro, fabriqué par Phi Optics (Champaign, IL), nous avons intégré des tiges de verre de 7 m de diamètre, qui sont utilisées comme espaceurs dans les écrans à cristaux liquides, dans un montage Fisher Permount. moyen (Fisher Scientific, https://www.fishersci.com). Les IR des tiges de verre et du milieu Permount à la longueur d'onde de 546 nm sont respectivement de 1,56 et 1,524. Les images ont été obtenues à l'aide d'objectifs à immersion dans l'huile 100 ×/1,4 NA. Le CellVista SLIM a capturé et traité quatre images en contraste de phase aux différents biais.

Estimation de la densité du contenu cellulaire

Pour obtenir des courbes d'étalonnage des IR des protéines et des acides nucléiques (Figure supplémentaire S3), de l'albumine de sérum bovin (BSA Sigma A-9418) et de l'ADN de sperme de saumon (Fisher Scientific BP-2514) ont été dissous dans un milieu de culture cellulaire à des concentrations de 0 –200 et 0-30 mg/ml, respectivement. Les IR des solutions étalons préparées ont été mesurés avec un réfractomètre, Abbé-3L (Bausch & Lomb). The measured RIs and solution densities were plotted and fitted with linear functions to obtain calibration curves.

We estimated intracellular density distribution from obtained OPD maps using the following two steps (Figure 1B). First, we calculated the RI from the OPD. Because the OPD is proportional to the thickness of a sample and the difference in RI between the sample and the surrounding solution, as shown in Figure 1B, we calculated the RI of samples on the basis of the RI of the surrounding solution and sample thickness. Second, we obtained the dry mass density (“density” for short) of the sample from its RI, because the RI of a sample is proportional to its density. For proteins and nucleic acids, which are the dominant materials in mammalian cells (>60% of dry mass) (Alberts et al., 2007), our calibration curves (Supplemental Figure S3 see above) of RI versus dry mass density using BSA and salmon sperm DNA showed that both were well fitted to linear functions and were almost identical (RI = 1.3375 + 1.4 × 10 –4 × C, où C is dry mass density). Therefore, dry mass density in live cells, which consists mainly of proteins and nucleic acids, was calculated from their RI using a single calibration curve (Supplemental Figure S3). To estimate the densities of the total cell contents, we measured the average thickness of the cytoplasm and nucleus in each cell line (Supplemental Figure S1, A and B). The pericentric foci were assumed to be spherical (Supplemental Figure S1C). To obtain the RI of cytoplasm (RIcy), we used the RI of the surrounding culture medium (RImed, 1.3375) (Supplemental Figure S2). For the RIs of the nucleus and the pericentric foci, we used our calculated values of RIcy and RInuc, respectively (Supplemental Figure S2). These estimates were created using ImageJ software.

EGFP-MeCP2 construction

A plasmid containing MeCP2-EGFP was kindly provided by M.C. Cardoso (Brero et al., 2005). The moiety of MeCP2-EGFP was cut by Xhomoi et XbaI enzymes and blunted. The blunted fragment was inserted into the ÉcoRV site of the pEF5/FRT/VS-DEST Gateway Vector (Invitrogen) to generate pEF5-MeCP2-EGFP-FRT.

EGFP-mH3.1p-H3.1 construction

A mouse histone H3.1 promoter (∼840 base pairs)-H3.1 fragment was amplified from mouse embryonic stem (ES) cell genomic DNA by PCR using the following primer set:

5′-AGCCCTCTCCCCGCGGATGCGGCGGGCCAGCTGGATG­TCC-3′. The amplified fragment was cloned into an EGFP vector to obtain pmH3.1p-H3.1-EGFP. Then two more insert sequences were prepared. One was the H3.1promoter-H3.1-EGFP amplified from the pmH3.1p-H3.1-EGFP vector using the following primer set:

and 5′-TTACTTGTACAGCTCGTCCATGCCGAGAGT-3′. The other was the 3′ untranslated region of H3.1 (∼500 base pairs) amplified from the mouse ES genome using the primer pair: 5′-TGGACGAGC­TGTACAAGTAAAGTTCGTCTTTCTGTGTTTTTCAAA­GGCTC-3′

For backbone vector preparation, the region from the EF1α-promoter to the BGH polyadenylation signal sequence was removed from pEF5/V5-FRT Gateway (Invitrogen) to create the pFRT-Hygromycin vector. The pFRT-Hygromycin vector, H3.1promoter-H3.1-EGFP sequence, and 3′ untranslated region sequence were ligated by SLIC (Li and Elledge, 2007) to prepare the pmH3.1p-H3.1-EGFP-3′UTR-FRT plasmid. In addition, upstream of the H3.1 promoter, an insulator fragment (tandem cHS4 kindly provided by G. Felsenfeld) was inserted to obtain pIx2-mH3.1p-H3.1-EGFP-3′UTR-FRT.

EGFP-fibrillarin construction

To clone the fibrillarin gene, total RNA was isolated from NIH3T3 cells using the RNeasy Mini Kit (Qiagen), and first-strand cDNA was synthesized using the SuperScript III First-Strand Synthesis System (Thermo) with oligo(dT). The coding region of fibrillarin was amplified from the first-strand cDNA using the following primer pair: 5′-GGGGTACCATGAAGCCAGGTTTCAGCCC-3′ and 5′-GCGGGA­TCCTCAGTTCTTCACCTTGGGAG-3′. The amplified fragment was digested with Kpnmoi et BamHI and ligated into KpnI/BamHI-digested pEGFP-C1 (Clontech, Palo Alto, CA). EGFP-fibrillarin fragments were excised, blunt-ended using T4 DNA polymerase (Takara, Japan), and inserted into ÉcoRV-precut pEF1-FRT to generate pEF1-EGFP-fibrillarin-FRT.

Cell culture and stable cell lines

We used RPE1, a human cell line, and NIH3T3, a mouse cell line. All of the cell lines were maintained in DMEM (Lonza) supplemented with 10% (vol/vol) fetal bovine serum (FBS) and 0.584 g/l l -glutamine (Sigma) at 37°C with 5% CO2 in air in a humidified incubator. To establish NIH3T3 cells expressing MeCP2-EGFP, EGFP-fibrillarin, or H3.1-EGFP, we used the Flp-In system (Invitrogen) as previously described (Maeshima et al., 2010 Hihara et al., 2012).

OI-DIC microscopy system

Details of the microcopy system are provided in the Supplemental Material.

Live-cell OI-DIC microscopy imaging

Cells were seeded on 24 mm × 24 mm square glass coverslips coated with poly d -lysine (Sigma) and cultured for 1–2 d. Then 30 min before imaging, 500 ng/ml Hoechst 33342 was added into the media and incubated further. The cells were mounted on a glass slide with a thin silicone spacer. We observed the mounted cells by OI-DIC and fluorescence imaging.

OI-DIC imaging of glass rods

A small number of glass rods 4 µm in diameter were suspended in two types of mineral oil with refractive indices of 1.54 and 1.58. Approximately 2 µl of the suspended solution was sandwiched between a glass slide and a coverslip, and then sealed with nail polish. The glass rods in the mineral oil were analyzed by OI-DIC microscopy using the same procedure as the live cell imaging.

Fixation

For formaldehyde fixation, cells on the square glass coverslips were washed once with phosphate-buffered saline (PBS), and then fixed in 4% formaldehyde at room temperature for 15 min. The fixed cells were washed with 10 mM HEPES-KOH, pH 7.5, 100 mM KCl, and 1 mM MgCl2 (HMK) (Maeshima et al., 2006) and permeabilized with 0.5% Triton X-100 in HMK at room temperature for 5 min. The treated cells were washed with HMK, stained with 500 ng/ml Hoechst 33342 in HMK at room temperature for 10 min, and then washed again with HMK. For MeOH fixation, cells on coverslips were fixed in ice-cold MeOH at –20°C for 30 min. Then the fixed cells were washed with HMK at room temperature for 15 min, stained with 500 ng/ml Hoechst 33342 in HMK for 10 min, and washed again with HMK. Finally, the cells were mounted on a glass slide and observed as described above.

Immunostaining of histone H3K9me3

Immunostaining was performed as previously described (Maeshima et al., 2010 Hihara et al., 2012). Cells were fixed in 2% formaldehyde (Wako) and permeabilized with Triton X-100. The primary and secondary antibodies were mouse anti-H3K9me3 (a generous gift from Hiroshi Kimura) and Alexa-Fluor-594-conjugated goat anti-mouse immunoglobulin G (Invitrogen) used at dilutions of 1:500 and 1:1000, respectively. Then DAPI (500 ng/ml) was added to the cells for 5 min, followed by washing with PBS prior to DNA staining. Images were obtained using a DeltaVision microscopy imaging system (Applied Precision) or a FLUOVIEW FV1000 confocal laser scanning microscope (OLYMPUS).

Measurements of cell thicknesses

Live RPE1 and NIH3T3 cells were seeded on 35 mm glass-bottom dishes. To fluorescently label DNA and cytoplasm, cells were incubated in culture medium containing 0.5 µg/ml Hoechst 33342 (Dojindo) and 5 µg/ml Calcein-AM (Dojindo) for 30 min. After washing out excess fluorescent dye, the stained cells were observed under an OLYMPUS FLUOVIEW FV1000 confocal laser scanning microscope equipped with a 60 ×/1.2 NA water objective. Hoechst 33342 and Calcein-AM fluorescence signals were acquired as three-dimensional image stacks (500 nm × 32 sections). The thicknesses of three regions (nucleus, cytoplasm, entire cell see Supplemental Figure S1) were measured in each cell line from the acquired stack images by ImageJ software.

Measurement of nuclear volume of live cells

Image stacks of live NIH3T3 and RPE1 cells acquired to measure cell thickness (described above) were used. The images were converted into binary images by auto thresholding in ImageJ software. Then the volumes of binary image stacks were analyzed using the 3D Objects Counter ImageJ plugin (Bolte and Cordelieres, 2006).

Quantification of fluorescence from Hoechst-stained DNA, MeCP2-EGFP, and α-H3K9me3

Image stacks of live or immunostained NIH3T3 cells (described above) were used. The middle sections of Hoechst-stained nuclei were selected from the z-stack images. The highest intensity of a focal plane of heterochromatin and the mean intensity of the surrounding low-intensity region in a nucleus were taken as the intensities of heterochromatin and the surrounding euchromatin. These values were adjusted to account for the background intensity.

Composition estimation of euchromatin and heterochromatin in live cells

The genome size of diploid mouse cells is 5.6 × 10 9 base pairs. Because 1 pg of DNA is 978 × 10 6 base pairs (978 × 10 6 base pairs/pg), the mass of the whole mouse genome is 5.73 pg. If we assume that nucleosomes (core histones + DNA) form every 200 base pairs of the genome and that the mass ratio of core histones to DNA is around 1:1, the mass of the nucleosomes in a mouse nucleus is 11.5 pg (5.73 × 2). The average mouse nuclear volume was calculated to be ∼1000 µm 3 (Supplemental Figure S6B), and the density of nucleosomes in mouse euchromatin was calculated to be 11.5 mg/ml. Further estimates are described under Résultats.

Monte Carlo simulation

Monte Carlo simulation is a computational algorithm that performs a numerical integration by making a random movement and evaluating whether the movement is acceptable based on the change in potential energy (Hibino et al., 2017). All of the molecules in the simulations were treated as hard spherical bodies. We employed a Metropolis Monte Carlo method without long-range potential or hydrodynamic interactions to determine the diffusive motion of molecules (Morelli and ten Wolde, 2008). The diameters and diffusion coefficients (s) of the crowding agents used in the simulations were 9.6 nm and 9 µm 2 s −1 , respectively, which are comparable to those of a single nucleosome molecule. Les s of tracers (spheres with diameters of 5, 10, 15, and 20 nm) were 18, 9, 6, and 4.5 µm 2 s −1 , respectively. Ces s were determined by the Stokes–Einstein relationship based on parameters from the EGFP monomer, the diameter and of which were 3.8 nm and 23.5 µm 2 s −1 , respectively (Hihara et al., 2012). Simulations were conducted in a 210-nm cubic box with two compartments (left and right halves) with periodic boundaries to avoid problems caused by finite space, and make the system more like an infinite one. For the “nucleosomes only” scenario, which corresponds to 11.5 mg/ml (euchromatin) and 85.9 mg/ml (heterochromatin), 134 and 968 copies of 9.6 nm spheres (crowding agents) were randomly placed in the left and right halves of the box, respectively. These crowding agents mimicked nucleosomes displaced less than 5 nm from their initial positions at t = 0 s (the “dog on a leash” model see also Hihara et al., 2012, and Maeshima et al., 2015). Then 50 tracers that could diffuse freely were placed in the left (euchromatin) region. The motion of the molecules was iteratively simulated following previously described procedures (Hihara et al., 2012 Maeshima et al., 2015). For the second simulation (nucleosomes + nonnucleosomal materials), 1578 and 1578–3945 9.6 nm spheres (crowding agents) were randomly placed in the left and right regions of the box, respectively, to represent euchromatin and heterochromatin (1.53–2.5-fold density differences). To represent nucleosomes, 134- and 968 9.6-nm spheres were randomly placed in the left and right regions, with their behavior following the “dog on a leash” model. The rest of the spheres moved freely only in each half, to represent diffusing proteins and RNAs. Then 50 tracers were placed in the left (euchromatin) region. Although the simulation process was similar to the first simulation, we restricted the movements of crowding agents to within their regions to keep the density of each region constant. Results were obtained by averaging 150 samples from three independent trials. The simulation time step, Δt, was 10 ns.

Analyses statistiques

All of the statistical analyses were performed using the two-tailed Student’s t test. p values less than 0.05 were considered statistically significant.


Voir la vidéo: Structure of a chromosome and zoom in to DNA (Décembre 2022).